[6238 Search Results


pkra7 antagonist  (Tocris)
90
Tocris pkra7 antagonist

Pkra7 Antagonist, supplied by Tocris, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pkra7 antagonist/product/Tocris
Average 90 stars, based on 1 article reviews
pkra7 antagonist - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
β catenin sirna  (Cell Signaling Technology Inc)
91
Cell Signaling Technology Inc β catenin sirna
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
β Catenin Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/β catenin sirna/product/Cell Signaling Technology Inc
Average 91 stars, based on 1 article reviews
β catenin sirna - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier
95 3 mean sd conclusion  (Mikromol)
86
Mikromol 95 3 mean sd conclusion
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
95 3 Mean Sd Conclusion, supplied by Mikromol, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/95 3 mean sd conclusion/product/Mikromol
Average 86 stars, based on 1 article reviews
95 3 mean sd conclusion - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier
macromelt® 6238  (Henkel Corporation)
90
Henkel Corporation macromelt® 6238
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
Macromelt® 6238, supplied by Henkel Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/macromelt® 6238/product/Henkel Corporation
Average 90 stars, based on 1 article reviews
macromelt® 6238 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
transducer #6238  (Utah Medical)
90
Utah Medical transducer #6238
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
Transducer #6238, supplied by Utah Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/transducer #6238/product/Utah Medical
Average 90 stars, based on 1 article reviews
transducer #6238 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
mn (mno) 6238 mg  (Trouw Nutrition USA LLC)
90
Trouw Nutrition USA LLC mn (mno) 6238 mg
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
Mn (Mno) 6238 Mg, supplied by Trouw Nutrition USA LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mn (mno) 6238 mg/product/Trouw Nutrition USA LLC
Average 90 stars, based on 1 article reviews
mn (mno) 6238 mg - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
compound 3-[1-[(aminocarbonyl)amino]-5-(4-methoxyphenyl)-1h-pyrrol-2-yl] propanoic acid chemdiv_id: 6238-0047  (Chemdiv Inc)
90
Chemdiv Inc compound 3-[1-[(aminocarbonyl)amino]-5-(4-methoxyphenyl)-1h-pyrrol-2-yl] propanoic acid chemdiv_id: 6238-0047
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
Compound 3 [1 [(Aminocarbonyl)Amino] 5 (4 Methoxyphenyl) 1h Pyrrol 2 Yl] Propanoic Acid Chemdiv Id: 6238 0047, supplied by Chemdiv Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/compound 3-[1-[(aminocarbonyl)amino]-5-(4-methoxyphenyl)-1h-pyrrol-2-yl] propanoic acid chemdiv_id: 6238-0047/product/Chemdiv Inc
Average 90 stars, based on 1 article reviews
compound 3-[1-[(aminocarbonyl)amino]-5-(4-methoxyphenyl)-1h-pyrrol-2-yl] propanoic acid chemdiv_id: 6238-0047 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
ice chest 40 qt wheeled cooler 6238-6341  (The Coleman Company Inc)
90
The Coleman Company Inc ice chest 40 qt wheeled cooler 6238-6341
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
Ice Chest 40 Qt Wheeled Cooler 6238 6341, supplied by The Coleman Company Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ice chest 40 qt wheeled cooler 6238-6341/product/The Coleman Company Inc
Average 90 stars, based on 1 article reviews
ice chest 40 qt wheeled cooler 6238-6341 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
tem image of cuii cp 6238  (Verlag GmbH)
90
Verlag GmbH tem image of cuii cp 6238
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
Tem Image Of Cuii Cp 6238, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tem image of cuii cp 6238/product/Verlag GmbH
Average 90 stars, based on 1 article reviews
tem image of cuii cp 6238 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
dbr erba wilhelmstrasse 2 b 6238 hofheirn/taunus  (ERBA Diagnostics)
90
ERBA Diagnostics dbr erba wilhelmstrasse 2 b 6238 hofheirn/taunus
δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of <t>LC3,</t> <t>β-catenin,</t> and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.
Dbr Erba Wilhelmstrasse 2 B 6238 Hofheirn/Taunus, supplied by ERBA Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dbr erba wilhelmstrasse 2 b 6238 hofheirn/taunus/product/ERBA Diagnostics
Average 90 stars, based on 1 article reviews
dbr erba wilhelmstrasse 2 b 6238 hofheirn/taunus - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
precursor mirna expression clone for mouse mmu-mir-6238  (Genecopoeia)
N/A
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
   Buy from Supplier
miracle mmu-mir-6238 mirna agomir antagomir  (AcceGen Biotechnology)
N/A
MicroRNA: mmu-miR-6238 Accession Number: MIMAT0024859 Mature Sequence: UUAUUAGUCAGUGGAGGAAAUG mmu-miR-6238 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
   Buy from Supplier

Image Search Results


Journal: The EMBO Journal

Article Title: Single‐cell transcriptomics of suprachiasmatic nuclei reveal a Prokineticin‐driven circadian network

doi: 10.15252/embj.2021108614

Figure Lengend Snippet:

Article Snippet: Recombinant Prok2 was purchased from Sigma Aldrich (#SRP3146) and PKRA7 antagonist was purchased from Tocris Bioscience (#6238).

Techniques: Plasmid Preparation, Recombinant, Modification, RNAscope, Multiplex Assay, Software

δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of LC3, β-catenin, and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.

Journal: American Journal of Cancer Research

Article Title: δ-Catenin promotes cell migration and invasion via Bcl-2-regulated suppression of autophagy in prostate cancer cells

doi:

Figure Lengend Snippet: δ-Catenin siRNA disrupted migration and invasion ability and increased autophagy in RV/δ cells. RV/δ cells were transfected with control siRNA, δ-catenin siRNA#1, and δ-catenin siRNA#2. A. The wound-healing scratch assay was used to detect the cell migration ability of each group. Quantitative analysis of cell migration in 3 independent experiments (n=3). Magnification: 50×. B. The Transwell assay was used to analyze the invasion ability of each group. Quantitative analysis of cell invasion in 3 independent experiments (n=3). Magnification: 100×. C. Western blot analysis of LC3, β-catenin, and Bcl-2 protein levels in each group. The relative quantification of protein levels was performed using ImageJ software. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.

Article Snippet: Rapamycin (HY-10219) and bafilomycin A1 (HY-100558) were purchased from MedChemExpress (USA). δ-Catenin siRNA#1 (145777) and δ-catenin siRNA#2 (145778) were purchased from Thermo Fisher Scientific. β-Catenin siRNA#1 (6225) and β-catenin siRNA#2 (6238) were purchased from Cell Signaling Technology (USA).

Techniques: Migration, Transfection, Control, Wound Healing Assay, Transwell Assay, Western Blot, Quantitative Proteomics, Software

δ-Catenin downregulated autophagy via β-catenin transcriptional regulation of Bcl-2. A. 22RV1, RV/C, and RV/δ cells treated with 0, 50, 100, or 200 nM rapamycin. Western blots were used to analyze β-catenin protein levels in each group. B. RV/C cells were transfected with GFP control. RV/δ cells were transfected with GFP control and GFP-δ-catenin. Western blot analysis of LC3 and Bcl-2 protein levels in each group. C. QRT-PCR analysis of Bcl-2 mRNA levels. D. RV/C and RV/δ cells treated with β-catenin siRNA and control siRNA. Western blot analysis of LC3, β-catenin, Beclin1, and Bcl-2 protein levels in each group. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.

Journal: American Journal of Cancer Research

Article Title: δ-Catenin promotes cell migration and invasion via Bcl-2-regulated suppression of autophagy in prostate cancer cells

doi:

Figure Lengend Snippet: δ-Catenin downregulated autophagy via β-catenin transcriptional regulation of Bcl-2. A. 22RV1, RV/C, and RV/δ cells treated with 0, 50, 100, or 200 nM rapamycin. Western blots were used to analyze β-catenin protein levels in each group. B. RV/C cells were transfected with GFP control. RV/δ cells were transfected with GFP control and GFP-δ-catenin. Western blot analysis of LC3 and Bcl-2 protein levels in each group. C. QRT-PCR analysis of Bcl-2 mRNA levels. D. RV/C and RV/δ cells treated with β-catenin siRNA and control siRNA. Western blot analysis of LC3, β-catenin, Beclin1, and Bcl-2 protein levels in each group. Data are shown as means ± SD of 3 independent experiments. *P<0.05, **P<0.01, and ***P<0.001.

Article Snippet: Rapamycin (HY-10219) and bafilomycin A1 (HY-100558) were purchased from MedChemExpress (USA). δ-Catenin siRNA#1 (145777) and δ-catenin siRNA#2 (145778) were purchased from Thermo Fisher Scientific. β-Catenin siRNA#1 (6225) and β-catenin siRNA#2 (6238) were purchased from Cell Signaling Technology (USA).

Techniques: Western Blot, Transfection, Control, Quantitative RT-PCR